~ Office Supplies ~~ Buy Posters ~~ A-Z Products ~~ Website Advertising


Shotgun sequencing - Wikipedia

<<Up     Contents

Shotgun sequencing

Shotgun sequencing is a method used in genetics for sequencing long DNA strands. The DNA is first cut into small pieces by restriction enzymes. Then the pieces are sequenced individually. By doing this for several copies of the same long DNA strand, overlapping fragments are created. Finally, computer programs align these overlapping sequences and determine the original (long) sequence.

An extremely simplified example with only two sequences is as follows:

 Original strand         : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

 First shotgun sequence  : XXXAGCATGCTGCAG
                                          TCATGCTTAGGCTAXXXX

 Second shotgun sequence :                      TTAGGCTAXXXX
                           XXXAGCATGCTGCAGTCATGC

 Reconstructed strand    : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

In real-world applications, there are thousands or millions of sequences to deal with, with the addition of transcription and sequencing errors. The computational power required to re-align the sequence in real projects is enormous. For the shotgun sequencing of the human genome in the Human Genome Project run by Celera Genomics in 2000, several supercomputers were running some month nonstop to align all human DNA correctly.

wikipedia.org dumped 2003-03-17 with terodump




 
 
35 ct Very pink red gemmy RHODOCHROSITE Gorgeous gemstone freeform Single gem piece Very nice PRETTY
 35 ct Very pink red my RHODOCHROSITE Gorgeous freeform Single piece Very nice PRETTY 
 
17 grams light green new jade Serpentine gem stone Tumble polished cab cabbing rough 89 carat Nice
 17 grams light green new jade Serpentine Tumble polished cab cabbing 89 carat Nice 
 
78 carats CHRYSOBERYL gems stones Facet uncut raw rough gemstones crystals lot 4 to 5 ct 15 grams gr
 78 carats CHRYSOBERYL uncut raw crystals lot 4 to 5 ct 15 grams gr 
 
11 carats pink Rhodonite gem Polished rectangle blocks Cabbing cab cabochon rough gemstone freeforms
 11 carats pink Rhodonite Polished rectangle blocks Cabbing cab cabochon freeforms 
 
10 gram pink KUNZITE crystal specimen gem stone Cab cabbing cabochon rough uncut gemstone 51 carat 4
 10 gram pink KUNZITE crystal specimen Cab cabbing cabochon uncut 51 carat 4